View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20804_low_38 (Length: 242)
Name: NF20804_low_38
Description: NF20804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20804_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 3 - 224
Target Start/End: Original strand, 29145215 - 29145434
Alignment:
| Q |
3 |
tatccaacacatgtcggacacatttgacactcgtggttacattctctcaaattattactggtgtcaatgagaagtggcaatgtcgtgtccagtgtcaatg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29145215 |
tatccaacacatgtcggacacatttgacactcgtggttacattctctcaaattattactg-tgtcaatgagaagtggcaatgtcgtgtccagtgtcaatg |
29145313 |
T |
|
| Q |
103 |
cttcatacgttttcttttttggcacttgtttaggattttccaatcttaattttctgcatttattgctttctaagggctctctaattttaaatttatgata |
202 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29145314 |
cttcatacgtttt-ttttttggcacttgtttaggattttccaatcttaattttctgcatttattgctttctaagggctctctaattttaaatttatgata |
29145412 |
T |
|
| Q |
203 |
tgcttcgtgaatataactaagc |
224 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29145413 |
tgcttcgtgaatataactaagc |
29145434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University