View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20804_low_44 (Length: 213)
Name: NF20804_low_44
Description: NF20804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20804_low_44 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 102 - 166
Target Start/End: Complemental strand, 31059465 - 31059401
Alignment:
| Q |
102 |
attcaggatcaccaatttctgaacttttcaaacaattgagttggttaaattatatacagccatta |
166 |
Q |
| |
|
||||||||||||||| |||||||||| || |||| ||||| ||||||||| |||||||||||||| |
|
|
| T |
31059465 |
attcaggatcaccaacttctgaacttctcgaacagttgagctggttaaatcatatacagccatta |
31059401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 61 - 101
Target Start/End: Complemental strand, 31024445 - 31024405
Alignment:
| Q |
61 |
gtttgatgcttttgtacatgaactaaggtttgtcatccttt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31024445 |
gtttgatgcttttgtacatgaactaagggttgtcatccttt |
31024405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University