View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20805_high_8 (Length: 341)
Name: NF20805_high_8
Description: NF20805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20805_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 56 - 320
Target Start/End: Complemental strand, 31954339 - 31954075
Alignment:
| Q |
56 |
acctgtggttcttttgaacattttgctagggattgcatgcgtggaggcggtaacaacaacaacggtggcggtggatatggtggtggaagcacatcttgct |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31954339 |
acctgtggttcttttgaacattttgctagggattgcatgcgtggaggcggtaacaacaacaacggtggcggtggatatggtggtggaggcacatcttgct |
31954240 |
T |
 |
| Q |
156 |
acaggtgtggtggggttggtcacatagcaagagattgcgctactcctagtagcggaggtggtggaggcggcgcttgctataagtgcggtgaggtgggtca |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31954239 |
acaggtgtggtggggttggtcacatagcaagagattgcgctactcctagtagcggaggtggtggaggcggcgcttgctataagtgcggtgaggtgggtca |
31954140 |
T |
 |
| Q |
256 |
catagctagggattgcagcaatgaagggggaaggtttgatggtggcaatggaaggtatgatgatg |
320 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31954139 |
catagctagggattgcagcaatgaaggaggaaggtttgatggtggcaatggaaggtatgatgatg |
31954075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University