View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20806_low_5 (Length: 251)

Name: NF20806_low_5
Description: NF20806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20806_low_5
NF20806_low_5
[»] chr6 (1 HSPs)
chr6 (119-238)||(16343382-16343503)


Alignment Details
Target: chr6 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 119 - 238
Target Start/End: Complemental strand, 16343503 - 16343382
Alignment:
119 catcctgtttttcgtaacctgatagatttcactaaactttagttt-ctttataactcgatagttttgagaatctt-aatatttttcattttgacaagttt 216  Q
    ||||||||||||| |||| | ||||||| |||||||||| ||||| ||||||||||||||||||||||||||||| |||||||||||| |||||||||||    
16343503 catcctgtttttcctaacttcatagattacactaaacttcagttttctttataactcgatagttttgagaatctttaatatttttcatattgacaagttt 16343404  T
217 tctattttgatctttgaaagtg 238  Q
    ||||||||||||||||||||||    
16343403 tctattttgatctttgaaagtg 16343382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University