View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20806_low_5 (Length: 251)
Name: NF20806_low_5
Description: NF20806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20806_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 119 - 238
Target Start/End: Complemental strand, 16343503 - 16343382
Alignment:
| Q |
119 |
catcctgtttttcgtaacctgatagatttcactaaactttagttt-ctttataactcgatagttttgagaatctt-aatatttttcattttgacaagttt |
216 |
Q |
| |
|
||||||||||||| |||| | ||||||| |||||||||| ||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
16343503 |
catcctgtttttcctaacttcatagattacactaaacttcagttttctttataactcgatagttttgagaatctttaatatttttcatattgacaagttt |
16343404 |
T |
|
| Q |
217 |
tctattttgatctttgaaagtg |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
16343403 |
tctattttgatctttgaaagtg |
16343382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University