View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20807_high_12 (Length: 350)
Name: NF20807_high_12
Description: NF20807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20807_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 1e-63; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 20 - 151
Target Start/End: Original strand, 27598947 - 27599078
Alignment:
| Q |
20 |
gttgcaactaactttggctccaaggccatcaacctaatcttctcgatctaaggccaatgagtagtttcaattcaattatatttataatataaaaacatta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27598947 |
gttgcaactaactttggctccaaggccatcaacctaatcttctcgatctaagtccaatgagtagtttcaattcaattatttttataatataaaaacatta |
27599046 |
T |
|
| Q |
120 |
tattgaagtagacacacccctaatgtatctag |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
27599047 |
tattgaagtagacacacccctaatgtatctag |
27599078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 175 - 234
Target Start/End: Original strand, 27599067 - 27599126
Alignment:
| Q |
175 |
taatgtatctagttttaatttgtctttataacgtgtatttaggtcggtatagtttctaga |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27599067 |
taatgtatctagttttaatttgtctttataacgtgtatttaggtcggtatagtttctaga |
27599126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 270 - 316
Target Start/End: Original strand, 27599163 - 27599209
Alignment:
| Q |
270 |
ttattattgatagtgatggaaccaactatagttttacatcagtctca |
316 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
27599163 |
ttattattgatagtgatggaagcaaggatagttttacatcagtctca |
27599209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University