View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20807_high_19 (Length: 262)
Name: NF20807_high_19
Description: NF20807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20807_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 8 - 248
Target Start/End: Complemental strand, 42902280 - 42902043
Alignment:
| Q |
8 |
gaaatgaaacaacaagtctaaaccaaggtcaagctaaacatgcataccattgtgaagaatcctctctatcataaagaatccaatgnnnnnnnnnnnnnnn |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42902280 |
gaaatcaaacaacaagtctaaaccaaggtcaagctaaacatgcataccattgtgaagaatcctctctatcataaagaatccaatgtttttttttttt--- |
42902184 |
T |
 |
| Q |
108 |
atataccagacatatccttaacaaactttatgttcaccccacatgcatatatacatttccataattaatcaaactcttgtacaaattctgattaacgact |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42902183 |
atataccagacatatccttaacaaactttatgttcacctcacatgcatatatacatttccataattaatcaaactcttgtacaaattctgattaacgact |
42902084 |
T |
 |
| Q |
208 |
ttgcttccatgtcaatgattgcggccatgttttgttctttg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42902083 |
ttgcttccatgtcaatgattgcggccatgttttgttctttg |
42902043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University