View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20807_low_15 (Length: 280)
Name: NF20807_low_15
Description: NF20807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20807_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 112 - 266
Target Start/End: Original strand, 39307389 - 39307543
Alignment:
| Q |
112 |
catgtctccctcacaatctttgcagcagcagccaaagcagcatcttcaccgttgaatatggcttctaaatcaatgacaggtacattcaactcttctttgc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39307389 |
catgtctccctcacaatctttgcagcagcagccaaagcagcatcatcaccgttgaatatggcttctaaatcaatgacaggtacattcaactcttctttgc |
39307488 |
T |
 |
| Q |
212 |
tggtttcaaccaaatcctcggatgaccagataaactcttgtggcacctttgcttc |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39307489 |
tggtttcaaccaaatcctcggatgaccagataaactcttgtggcacctttgcttc |
39307543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University