View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20808_high_32 (Length: 279)
Name: NF20808_high_32
Description: NF20808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20808_high_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 110 - 263
Target Start/End: Original strand, 8087450 - 8087603
Alignment:
| Q |
110 |
aattgacaatgatgctccaactcagagtgcttcctgatttactcaaggttctcaattttcactaccacctgatatcatgtccatagttacatttttgagn |
209 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
8087450 |
aattgataatgatgctccaactcagagtgcttcctgatttactcaaggttctcaattttcacaaccacctaatatcatgtccatagttacatttctgagt |
8087549 |
T |
 |
| Q |
210 |
nnnnnncttcagaaatcaataaaatccagaatgtatgtatcgttgttgctaatt |
263 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8087550 |
ttttttcttcagaaataaataaaatccagaatgtatgtatcgttgttactaatt |
8087603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 59 - 87
Target Start/End: Complemental strand, 8084654 - 8084626
Alignment:
| Q |
59 |
atccaatttaatctttctcattcactttt |
87 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8084654 |
atccaatttaatctttctcattcactttt |
8084626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University