View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20808_high_34 (Length: 274)
Name: NF20808_high_34
Description: NF20808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20808_high_34 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 274
Target Start/End: Complemental strand, 4109765 - 4109499
Alignment:
| Q |
18 |
ggtgcttgaggactacgtataggagtctttctgatttgtgtgttga-------tagtggtgtgacagtagttggtagtgtctgaaatcttgttttgcgaa |
110 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4109765 |
ggtgcttgaggactaggtctaggagtctttctgatttgtgtgttgagtgttgatagtggtgtgacagtagttggtagtgtctgaaatcttgttttaggaa |
4109666 |
T |
|
| Q |
111 |
ggatgggaattctccatgtcaaccatgccaacatttggtgatcatgctttgtaacttggaggtgcgtcgtataaagg---gaaaaaagagagtttatgag |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4109665 |
ggatgggaattctccatgtcaaccatgccgacatttggtgatcatgctttgtaacttggaggtgcgtcgtataaaggaaaaaaaaaagagagtttatgag |
4109566 |
T |
|
| Q |
208 |
cgtcctttcttgttcagtagaaataccacatacttatatctctatcaaataagaaaactcatatctt |
274 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4109565 |
cgtccttttttgtttagtagaaataccacatacttatatttctatcaaataagaaaactcatatctt |
4109499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University