View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20808_high_35 (Length: 270)
Name: NF20808_high_35
Description: NF20808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20808_high_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 38104594 - 38104332
Alignment:
| Q |
1 |
aaaaagcaactgcactgcgctgttatgatgtcatttggtttggttttggactaattattagttattacaannnnnnn-agaggtacttattacatatata |
99 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38104594 |
aaaaagcaactgcactgcactgttatgatgtcatttggtttggttttggactaattattagttattacaattttttttagaggtacttattacatatata |
38104495 |
T |
|
| Q |
100 |
tcttcatttacataattatgtctgatttgggcatttggctttggacagctattatgaannnnnnnnagttatgatggatttgaatttttca--------- |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38104494 |
tcttcatttacataattatgtctgatttgg--------ctttggacagctattatgaattttttttagttatgatggatttgaatttttcatacgaattt |
38104403 |
T |
|
| Q |
191 |
----ggtcataattccagctccattttgggttagttacccagaaatggcaaggttggccgatgcaacacct |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38104402 |
ttcaggtcataattccagctccattttgggttagttacccagaaatggcaaggttggccgatgcaacacct |
38104332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 186 - 256
Target Start/End: Complemental strand, 43514776 - 43514706
Alignment:
| Q |
186 |
tttcaggtcataattccagctccattttgggttagttacccagaaatggcaaggttggccgatgcaacacc |
256 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
43514776 |
tttcaggtcattattccagctccattctatgttagttacccagaaatggcaaggatggctgatgcaacacc |
43514706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University