View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20808_high_38 (Length: 265)
Name: NF20808_high_38
Description: NF20808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20808_high_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 13 - 164
Target Start/End: Original strand, 51690679 - 51690829
Alignment:
| Q |
13 |
aatatcaagtaaggtagatgtagactaaatcaagttagactttacaaatgtttaagcttgatctcatcaaaatatttaaggtcaaagattagtttattac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51690679 |
aatatcaagtaaggtagatgtagactaaatcaagttagactttacaa-tgtttaagcttgatctcatcaaaatatttaaggtcaaaggttagtttattac |
51690777 |
T |
|
| Q |
113 |
ctcttataaatttatttttatatttgaatacgccctttttgaaagtacgatg |
164 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51690778 |
ctcttataaatttgtttttatatttgaatacgccctttttgaaagtacgatg |
51690829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University