View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20808_high_44 (Length: 246)
Name: NF20808_high_44
Description: NF20808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20808_high_44 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 30 - 230
Target Start/End: Complemental strand, 30054721 - 30054519
Alignment:
| Q |
30 |
gcaacatatctgctcatttgctttccaacttttcttttattggatctctcaaccaaaaaccatgccatatccatctttgttctgttaaacacgtttacaa |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30054721 |
gcaacatatctgctcatttgctttccaacttttcttttattggatctctcaaccaaaaaccatgccatatccatctttgttctgttaaacatgtttacat |
30054622 |
T |
 |
| Q |
130 |
ggatgcagacatcggattc---aatcgcccgttggaagatgaatctgcagtcctactcaactggctactactagttttctaatatcaaatcattgactgt |
226 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30054621 |
ggatgcagacatcggattcattaatcgccccttggaagacgaatctgcagtcctactcaactggctactac-agttttctaatatcaaatcattgactgt |
30054523 |
T |
 |
| Q |
227 |
ctct |
230 |
Q |
| |
|
|||| |
|
|
| T |
30054522 |
ctct |
30054519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University