View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20808_high_61 (Length: 211)
Name: NF20808_high_61
Description: NF20808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20808_high_61 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 15 - 197
Target Start/End: Original strand, 8952012 - 8952209
Alignment:
| Q |
15 |
atgaatacagccaccgatattgaaaccaagacacactgctttgtgaagtctaaccctttttcgtagcaaacttgatattttcaagtagtgcttattggac |
114 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8952012 |
atgaatacagccaccaatattgaaaccaagacacactgctttgtgaagtctaaccctttttcgtagcaaacttgatattttcaagtagtgcttattggac |
8952111 |
T |
 |
| Q |
115 |
acaattactttgaatattgaatgtgcttata---------------agtaggattctcttcctttcataattgcaacaatgttgtcgatactactttt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8952112 |
acaattactttgaatattgaatgtgcttataaaaatgaacggagagagtaggattctcttcctttcatagttgcaacaatgttgtcgatactactttt |
8952209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University