View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20808_high_62 (Length: 209)
Name: NF20808_high_62
Description: NF20808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20808_high_62 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 4e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 96 - 209
Target Start/End: Original strand, 4109402 - 4109515
Alignment:
| Q |
96 |
tgcatgtttcgaacaaataatggattcagacaggtcaaacacactctggctcttgctggaacgggtccatcacttgaggatagatggatgactatggaag |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4109402 |
tgcatgtttcgaacaaataatggattcagacaggtcaaacatactctagctcctgctagaacgggtccatcacttgaggatagatggatgactatagaag |
4109501 |
T |
|
| Q |
196 |
atatgagttttctt |
209 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4109502 |
atatgagttttctt |
4109515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 4098830 - 4098910
Alignment:
| Q |
1 |
ataggttaaaagtgggtcttttttcctaaaattggttgttcttaaagcttattaggtcatacaacacctaaacctagattt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4098830 |
ataggttaaaagtgggtcttttttcctaaaattggttgttcttaaagcttattaggtcatacaacacctaaacctagattt |
4098910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 36 - 81
Target Start/End: Original strand, 20546661 - 20546706
Alignment:
| Q |
36 |
ttgttcttaaagcttattaggtcatacaacacctaaacctagattt |
81 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||| |||||||| |
|
|
| T |
20546661 |
ttgttcttaaaatttattaggtcatgcaacacctaaatctagattt |
20546706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University