View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20808_low_28 (Length: 329)
Name: NF20808_low_28
Description: NF20808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20808_low_28 |
 | |
|
| [»] scaffold0050 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0050 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 11 - 69
Target Start/End: Complemental strand, 8189 - 8131
Alignment:
| Q |
11 |
gtgagatgaatgagtggaagaaatttttatttctaaatcggctgtcattagttatgtac |
69 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
8189 |
gtgaaatgaatgagtggaagaaatttttatttctaaattggttgtcattagttatgtac |
8131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 151 - 217
Target Start/End: Complemental strand, 29500416 - 29500350
Alignment:
| Q |
151 |
aaaataaacatggaagtaatatcagtaatatattttaaaataagtggaaatgagatgtagaataatc |
217 |
Q |
| |
|
||||||||||||||||| || |||||||| |||||| | |||| |||||||||||| |||||||||| |
|
|
| T |
29500416 |
aaaataaacatggaagttatgtcagtaatttattttcacataaatggaaatgagatatagaataatc |
29500350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 139 - 200
Target Start/End: Original strand, 24779190 - 24779252
Alignment:
| Q |
139 |
aaataaataacgaaaa-taaacatggaagtaatatcagtaatatattttaaaataagtggaaa |
200 |
Q |
| |
|
||||| |||||||||| |||||||||||||||| ||| || | ||||||||||||| |||||| |
|
|
| T |
24779190 |
aaatatataacgaaaaataaacatggaagtaatttcaatagtttattttaaaataaatggaaa |
24779252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University