View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20808_low_33 (Length: 277)
Name: NF20808_low_33
Description: NF20808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20808_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 42867203 - 42867439
Alignment:
| Q |
1 |
ccgatgcttatgagttcgaggatcaatctacgtattcactcatcaataaaatattgagctcatgctaacctaatttttgtttttgatttgttagactgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42867203 |
ccgatgcttatgagttcgaggatcaatctacgtattcactcatcaataaaatattgagctcatgctaacctaatttttgtttttgatttgttagactgta |
42867302 |
T |
|
| Q |
101 |
tttgcggctctagtctcgtgttacatcctgtttctcttgtactccatcttccaccaagtttcatctccatgggaactggtatgcttcaagtaccctagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42867303 |
tttgcggctctagtctcgtgttacatcctgtttctcttgtactccatcttccaccaagtttcatctccatgggaactggtatgcttcaagtaccctagtt |
42867402 |
T |
|
| Q |
201 |
tctttcgactacgaaacaataattcatatgcaagata |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42867403 |
tctttcgactacgaaacaataattcatatgcaagata |
42867439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 80 - 148
Target Start/End: Original strand, 42873307 - 42873375
Alignment:
| Q |
80 |
tttttgatttgttagactgtatttgcggctctagtctcgtgttacatcctgtttctcttgtactccatc |
148 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||| |||| ||||||||||||||||| |||||||||||| |
|
|
| T |
42873307 |
tttttgatctgttaaactgtatttgcggctcttgtcttctgttacatcctgtttcttttgtactccatc |
42873375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University