View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20808_low_40 (Length: 255)

Name: NF20808_low_40
Description: NF20808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20808_low_40
NF20808_low_40
[»] chr2 (2 HSPs)
chr2 (15-82)||(40665605-40665672)
chr2 (15-82)||(40724382-40724449)


Alignment Details
Target: chr2 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 15 - 82
Target Start/End: Complemental strand, 40665672 - 40665605
Alignment:
15 acatcatcataaccaacttcatcaagtctttcttcatcctctcttttcacaggttccccctcacagaa 82  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
40665672 acatcatcataaccaacttcatcaagtctttcttcatcatctcttttcacaggttccccctcacagaa 40665605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 15 - 82
Target Start/End: Original strand, 40724382 - 40724449
Alignment:
15 acatcatcataaccaacttcatcaagtctttcttcatcctctcttttcacaggttccccctcacagaa 82  Q
    |||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||| |||||    
40724382 acatcatcataaccgacttcatcaagcctttcttcatcctctcttttcacgggttccccctcgcagaa 40724449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University