View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20808_low_48 (Length: 239)
Name: NF20808_low_48
Description: NF20808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20808_low_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 39 - 221
Target Start/End: Complemental strand, 27763629 - 27763448
Alignment:
| Q |
39 |
ttttaataaatgcaaatacgatgaaacgagggtgaaatacacagtgcannnnnnnnnnnnnactataagtctttctgagtgtgagttttcttagagtttc |
138 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27763629 |
ttttaataaatgcaaatacgatgaaatgagggtgaaatacacagtgcatatttttttttt-actataagtct----gagtgtgagttttcttagagtttc |
27763535 |
T |
|
| Q |
139 |
ct---gtctactgataattataaatgaatcaccaatcaat-attcacaagacattatgatgctttacttgtttttacactaatacat |
221 |
Q |
| |
|
|| |||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27763534 |
ctcctgtctactgataattataaatgaatcagcaatcaattattcacaagacattatgatgctttagttgtttttacactaatacat |
27763448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 27764089 - 27764043
Alignment:
| Q |
1 |
cttcacgatatcgaatattttcctaaaattatacatcattttaataa |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27764089 |
cttcacgatatcgaatattttcctaaaattatacatcattttaataa |
27764043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University