View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20808_low_50 (Length: 238)
Name: NF20808_low_50
Description: NF20808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20808_low_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 231
Target Start/End: Original strand, 21129663 - 21129876
Alignment:
| Q |
19 |
gattaatgagttgtcacaacttatttatcgtattctttaatcattcacttaatagaacggcgttaaccatcaaattattgtcgaagttttgttgccaaag |
118 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21129663 |
gattaatgagttgtcacaccttatttatcgtattctttaatcattcacttaatagaacggcgttaaccatcaaattattgtcgaagttttgttgccaaat |
21129762 |
T |
 |
| Q |
119 |
ttttgtaaaaatatcacttctgattctaaa-gaagttacttttgatgttggtgacagtgcaattgccaaatatctgtctgatgacctcccttacgaacta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21129763 |
ttttgtaaaaatatcacttctgattctaaacgaagttacttttgatgttggtgacagtgcaattgccaaatatctgtctgatgacctcccttatgaacta |
21129862 |
T |
 |
| Q |
218 |
tcgtctgatgatgt |
231 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
21129863 |
tcgtctgatgatgt |
21129876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University