View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20808_low_59 (Length: 220)
Name: NF20808_low_59
Description: NF20808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20808_low_59 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 49 - 219
Target Start/End: Complemental strand, 48596063 - 48595893
Alignment:
| Q |
49 |
aaccgccacatcttaccatttcgatcttcaaaatttaggagaagccctttctcgttggtagaagaatccaaagggaagtacttctctgcgtgttgctttg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48596063 |
aaccgccacatcttaccatttcgatcttcaaaatttaggagaagccctttctcgttggtagaagaatccaaagggaagtacttctctgcgtgttgctttg |
48595964 |
T |
 |
| Q |
149 |
gaatcacaagtcgattcagtttccctacgtcactaggtgtcaccactttgtcaaacatatgctctttctct |
219 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48595963 |
gaatcacaagtcgatttagtttccctacgtcactaggtgtcaccactttgtcaaacatatgctctttctct |
48595893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University