View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20809_high_22 (Length: 324)
Name: NF20809_high_22
Description: NF20809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20809_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 307
Target Start/End: Original strand, 41318505 - 41318812
Alignment:
| Q |
1 |
atatatgactattacaactattctcatatgtaactgctttgttcctccgctggttcaaatttaatctcaggattgaaccgattgctagaattcctaactc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41318505 |
atatatgactattacaactattctcatatgtaactgctttgttcctccgctggttcaaatttaatctcaggattgaaccgactgctagaattcctaactc |
41318604 |
T |
 |
| Q |
101 |
tc--gatgagtttttggaattcgactgcctattaattagatggatactatgaattttgtacttatctctaagctacgaggtttgaatctcatataagtcg |
198 |
Q |
| |
|
|| |||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41318605 |
tcttgatgagtttttgcaatccgactgcctattaattagatggatactatgaattttgtacttatctctaagctacgaggtttgaatctcatataagtcg |
41318704 |
T |
 |
| Q |
199 |
tatagacccgtccaagtgtttagattatcctgtaatagttttagtgtgtttgttttcacgtttctctcttttttcttacgccccaaaagcaatattgccg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
41318705 |
tatagacccgtccaagtgtttagattatcctgtaatagttttagtgtgtttgttttcacgtttctctcttttttcttacgcccc-aaagcaatattgctg |
41318803 |
T |
 |
| Q |
299 |
tgattttaa |
307 |
Q |
| |
|
||||||||| |
|
|
| T |
41318804 |
tgattttaa |
41318812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University