View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20809_high_27 (Length: 302)
Name: NF20809_high_27
Description: NF20809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20809_high_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 22 - 290
Target Start/End: Original strand, 10932344 - 10932612
Alignment:
| Q |
22 |
tccccttcaccgaaaccgaagcatgtaacgtcttctgcgcgaatcttaagagttgcttctttttctccatcctcctcttaatcatccttgccacgtttgc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10932344 |
tccccttcaccgaaaccgaagcatgtaatgtcttctgcgcgaatcttaagagttgcttctttttctccatcctcctcttaatcatccttgccacgtttgc |
10932443 |
T |
 |
| Q |
122 |
cctcatctacgtcgaggacacaccgaagacaaagccagaggtgaaggatgctgatgagacaccggttacttgtttcggagagttgttcggtgcattcaag |
221 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10932444 |
cctcatctacgtcgaggacacaccaaagacaaagccagaggtgaaggatgctgatgagacaccggttacttgtttcggagagttgtttggtgcattcaag |
10932543 |
T |
 |
| Q |
222 |
gaattaaagagaccaatgtggatattgatgttagtaacagccgtgaactggatcgcgtggttcccgttc |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10932544 |
gaattaaagagaccaatgtggatattgatgttagtaacagccgtgaactggatcgcgtggttcccgttc |
10932612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University