View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20809_high_29 (Length: 297)
Name: NF20809_high_29
Description: NF20809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20809_high_29 |
 | |
|
| [»] scaffold0536 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0536 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: scaffold0536
Description:
Target: scaffold0536; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 134 - 280
Target Start/End: Original strand, 7538 - 7686
Alignment:
| Q |
134 |
agacggattgtcaaatatcacatgaaaaccta--cacacaaatgaatttaggcatttttcaattgagtcaaaacctgctgataatacttttctttatgtg |
231 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
7538 |
agactgattgtcaaatatcacatgaaaacctatacacacagatgaatttaggcatttttcaattgagtcaaaacctgcggataatacttttctttgtgtg |
7637 |
T |
|
| Q |
232 |
ttaatcttccggttaccaggaatgagatcttggtaatcctgtggataat |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7638 |
ttaatcttccggttaccaggaatgagatcttggtaatcctgtggataat |
7686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0536; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 7426 - 7527
Alignment:
| Q |
1 |
ggaagattatgttcattatgctctaaagaaatgtaaactaatttatttacatataatactaccaaccatgtgttggtaggcacaaaataagtgttcaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7426 |
ggaagattatgttcattatgctctaaagaaatgtaaactaatttatttacatataatactaccaaccatgtgttggtaggcactaaataagtgttcaaat |
7525 |
T |
|
| Q |
101 |
ga |
102 |
Q |
| |
|
|| |
|
|
| T |
7526 |
ga |
7527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University