View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20809_high_34 (Length: 251)
Name: NF20809_high_34
Description: NF20809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20809_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 34602297 - 34602529
Alignment:
| Q |
1 |
ttttacttggtctattctctctcttgctgcaaagtttggaaattagattggtcaatacattaa-cacaccgactatatgattttgcggtattattaatta |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34602297 |
ttttacttggtctattctctctcttgctgcaaagtttggaaattagattggtcaatacattaaacacaccgactatatgattttgcggtattattaatta |
34602396 |
T |
 |
| Q |
100 |
ctatattaagtaaacaatattgatgagagtccactgcttagaacttttata-tacggcaagattttatagctttgttcgtttctttgaattaattattaa |
198 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34602397 |
ctatattaagtaa-caatattgatgagagtccactgcttagaacttttataatacggcaatattttatagctttgttcgtttctttgaattaattattaa |
34602495 |
T |
 |
| Q |
199 |
tattcctttcattattattgtgacacttatataa |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34602496 |
tattcctttcattattattgtgacacttatataa |
34602529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University