View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20809_high_36 (Length: 248)
Name: NF20809_high_36
Description: NF20809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20809_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 16 - 244
Target Start/End: Original strand, 26482349 - 26482577
Alignment:
| Q |
16 |
tattgagttgacaaatcacccaattattaaggcatactattagtatattttggaaaattcctatattagtgaaaattgaagttgtggtccacccagaccc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26482349 |
tattgagttgacaaatcacccaattattaaggcatactattagtatattttcgaaaattcctatattagtgaaaattgaagttttggtccacccagaccc |
26482448 |
T |
 |
| Q |
116 |
aaaataaaatagaaaaactgaaaggagtggacccattttttgtgctatggaacacgcccacgtggcagtcatatcagtagggcccagagcccacggcctc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26482449 |
aaaataaaatagaaaaactgaaaggagtggacccattttttgtgctatggaacacgcccacgtggcagtcatatcagtagggcccagagcccacggcctc |
26482548 |
T |
 |
| Q |
216 |
tgttatggatatatcgattggctctctgc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26482549 |
tgttatggatatatcgattggctctctgc |
26482577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University