View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20809_high_43 (Length: 238)
Name: NF20809_high_43
Description: NF20809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20809_high_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 26482162 - 26481943
Alignment:
| Q |
1 |
taaaaaagttctcgctctcatatttataaagttctaattctttcttttgctaatgtacaagattatcttcatcttctttgacaaacttatttttaacgcg |
100 |
Q |
| |
|
|||||| |||| ||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
26482162 |
taaaaatgttcccgcactcgtatttataaagttctaattctttcttttgctaatgtacaagattatcttcatcttctttgacaaacttattcttaatgcg |
26482063 |
T |
 |
| Q |
101 |
tcatttcgctcaaactaacaattgg-nnnnnnnngatgatagtggttgaaatcagttattgaattttacatcgaataaatacaattggtcaatgttattg |
199 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| | ||||||||| ||||||||||||| |
|
|
| T |
26482062 |
tcatttcgctcaaactaacaattggttttttgttgatgatagtggttaaaatcagttattgaattttacatcgact-aatacaatt-gtcaatgttattg |
26481965 |
T |
 |
| Q |
200 |
tatatttatatcatgaagtttt |
221 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
26481964 |
tatatttaaatcatgaagtttt |
26481943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University