View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20809_high_52 (Length: 215)
Name: NF20809_high_52
Description: NF20809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20809_high_52 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 75 - 215
Target Start/End: Original strand, 36917608 - 36917748
Alignment:
| Q |
75 |
gtttgaaataaatatgattttcttccaggaccaaaatcaagtggggctaaagtatttaacaacaggcccattagttggaggaattactatcattatatag |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36917608 |
gtttgaaataaatatgattttcttccaggaccaaaatcaagtggggctaaagtatttaacaacaggcccattagttggaggaattactatcattatatag |
36917707 |
T |
 |
| Q |
175 |
ggcaaactcaagacactaaaatggtattgaagtaccactac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36917708 |
ggcaaactcaagacactaaaatggtattgaagtaccactac |
36917748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 36917539 - 36917590
Alignment:
| Q |
1 |
gcttgaactatcaaagaaattggatagtacagtatgtatgtaacaataagtatatga |
57 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
36917539 |
gcttgaactatcaaagaaattggatagtata-----tatgtaacaataagtatatga |
36917590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University