View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20809_low_31 (Length: 289)
Name: NF20809_low_31
Description: NF20809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20809_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 9 - 136
Target Start/End: Complemental strand, 43129065 - 43128934
Alignment:
| Q |
9 |
acatcatcacatttgatatattgcttggcaccatgaatctttatattttgactctgtctcatataaacagtagagtg---agatcgtgaaaaaat-taaa |
104 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||| | ||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| | |||| |
|
|
| T |
43129065 |
acatcatcacatttgatatattggttgtcaccaaggatctttatattttgactctgtttcatataaacagtagagtgagcagatcgtgaaaaattataaa |
43128966 |
T |
|
| Q |
105 |
gcgttaccctggtggtatagattgacttattt |
136 |
Q |
| |
|
|||||||| |||||| ||| |||||||||||| |
|
|
| T |
43128965 |
gcgttaccttggtggaatatattgacttattt |
43128934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 217 - 272
Target Start/End: Complemental strand, 19178379 - 19178324
Alignment:
| Q |
217 |
atctgaatttattttctacagcataaacctcataacaatgctacttatacacatac |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||| ||| |||||||||| |
|
|
| T |
19178379 |
atctgaatttattttctacagcataaacctcagaataatgcaactcatacacatac |
19178324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University