View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20809_low_39 (Length: 245)
Name: NF20809_low_39
Description: NF20809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20809_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 23 - 229
Target Start/End: Original strand, 23803100 - 23803306
Alignment:
| Q |
23 |
gacggatccaagctcgtccacgacaaccattgtcacttttccggttgcaaacacattcttcactgtcccctccaactttctacaccctgttgcagctgtg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23803100 |
gacggatccaagctcgtccacgacaaccattgtcacttttccggttgcaaacacattcttcactgtcccctccaactttctacaccctgttgcagctgtg |
23803199 |
T |
 |
| Q |
123 |
aattgttgtataatatattgcgccgatgacgaaacctgtaacaaattgtaacaaaataaagatcactgaaaaaggatcaaactttacatatacatggtaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23803200 |
aattgttgtataatatattgcgccgatgacgaaacctgtaacaaattgtaacaaaataaagatcactgaaaaaggatcaaactttacatatacatggtaa |
23803299 |
T |
 |
| Q |
223 |
cattagt |
229 |
Q |
| |
|
||||||| |
|
|
| T |
23803300 |
cattagt |
23803306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University