View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20809_low_40 (Length: 243)
Name: NF20809_low_40
Description: NF20809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20809_low_40 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 36943391 - 36943166
Alignment:
| Q |
18 |
attatgattgttgtaattatataacgatgaagaattatcaacgcctctttcttttcaataatttattaacggatttaggccgtatcgtatccttaatttc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||| |||||||||||||| |
|
|
| T |
36943391 |
attatgattgttgtaattatataacgatgaagaattatcaatgcctctttcttttcaataatttattaacgggtttaggctgtattgtatccttaatttc |
36943292 |
T |
 |
| Q |
118 |
aaaaatattgtgtatctcatctatcgatctcacctgcacactgcgtatctcggcttcatagctctttttgcagcattaggctttaagaagaattgggtac |
217 |
Q |
| |
|
||||||||||||||| | ||||||||||| |||| ||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36943291 |
aaaaatattgtgtatttgatctatcgatcccacccgcacactacgtatctcagcttcatagctctttttgcagcattaggctttaagaagaattgggtac |
36943192 |
T |
 |
| Q |
218 |
agttaatgttacaggctaaactggtt |
243 |
Q |
| |
|
| ||||||||||||||||||||||| |
|
|
| T |
36943191 |
aagtaatgttacaggctaaactggtt |
36943166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University