View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20809_low_41 (Length: 240)

Name: NF20809_low_41
Description: NF20809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20809_low_41
NF20809_low_41
[»] chr3 (1 HSPs)
chr3 (1-224)||(50210518-50210741)


Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 50210741 - 50210518
Alignment:
1 gaaatggcttttgttgctactcatgctgctactgaatttgcagactgctgaagtgaaatgtgtcgtgcgctcatgcatcaaactgccaacatcacttgga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
50210741 gaaatggcttttgttgctactcatgctgctactgaatttgcagactgctgaagcgaaatgtgtcgtgcgctcatgcatcaaactgccaacatcacttgga 50210642  T
101 ccacctcccccaattgaggattggggatgtcttccttcattggagcagctgggactttcctcacagaatgtaggttttgccataagtatacctgtggata 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50210641 ccacctcccccaattgaggattggggatgtcttccttcattggagcagctgggactttcctcacagaatgtaggttttgccataagtatacctgtggata 50210542  T
201 tccatgcgagaatctagtcctttg 224  Q
    ||||||||||||||||||||||||    
50210541 tccatgcgagaatctagtcctttg 50210518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University