View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20809_low_43 (Length: 239)
Name: NF20809_low_43
Description: NF20809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20809_low_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 29 - 222
Target Start/End: Complemental strand, 42674660 - 42674467
Alignment:
| Q |
29 |
taagttcataggatgatatgcacactgtctttgtgattgcttttatgttttgttggtttgtgtgcttcttttatacaatgttgacaagaaggattaatca |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42674660 |
taagttcataggatgatatgcacactgtctttgtgattgcttttatgttttgttggtttgtgtgcttcttttatacaatgttgacaagaaggattaatca |
42674561 |
T |
 |
| Q |
129 |
tttgaacaggactaccccaccccatatggagggaacttgtgtgaaacataaaaaatgtatggctttcatctattttacattttcaataacaagc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42674560 |
tttgaacaggactaccccaccccatatggagggaacttgtgtgaaacataaaaagtgtatggctttcatctattttacattttcaataacaagc |
42674467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University