View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20809_low_47 (Length: 235)
Name: NF20809_low_47
Description: NF20809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20809_low_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 37848494 - 37848696
Alignment:
| Q |
20 |
gacgaagacatatagtgtgacttcttttatagataattctccctaactttgtaaccaaactcaaagaacaaaacaacctcattcatgaacttagtttctt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37848494 |
gacgaagacatatagtgtgacttcttttatagataattctccctaactttgtaaccaaactcaaagaacaaaacaacctcattcatgaacttagtttctt |
37848593 |
T |
 |
| Q |
120 |
tctctgtaacttgacaaggtaagtgtttcttatttcattgcaatttacaaacaaccttgtctcagtctcaatgaaaagaactagctatagcagtagaatt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37848594 |
tctctgtaacttgacaaggtaagtgtttcttatttcattgcaatttacaaacaaccttgtctcagtctcaatgaaaagaactagctatagcagtagaatt |
37848693 |
T |
 |
| Q |
220 |
atc |
222 |
Q |
| |
|
||| |
|
|
| T |
37848694 |
atc |
37848696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University