View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20809_low_49 (Length: 231)
Name: NF20809_low_49
Description: NF20809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20809_low_49 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 6 - 132
Target Start/End: Complemental strand, 17845477 - 17845353
Alignment:
| Q |
6 |
aatatatgttggccatgtggctaacggctgaaccccacacttatttcaacaattacgaattttagccctaacttctaagaaaacccctctaaaacctaaa |
105 |
Q |
| |
|
||||||||||||| ||||| | || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17845477 |
aatatatgttggcgatgtgac-aatggctgaaccccacacttatttcaacaattacgaattttagccctaacttctaagaaaa-ccctctaaaacctaaa |
17845380 |
T |
|
| Q |
106 |
caaccacatattgtgctatttttgaag |
132 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
17845379 |
caaccacatattgtgctatttttgaag |
17845353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 129 - 231
Target Start/End: Complemental strand, 17844510 - 17844403
Alignment:
| Q |
129 |
gaagtgaagttggattattttgttacatttcaacttatttta-----accggtaaacaaaaagttagttcacattaattcattcacttgttctttaattt |
223 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17844510 |
gaagtgaagttgaattattttgttacatttcaacttattttattttaaccggtaaacaaaaagttagttcacatttcttcattcacttgttctttaattt |
17844411 |
T |
|
| Q |
224 |
gtttttta |
231 |
Q |
| |
|
||||||| |
|
|
| T |
17844410 |
atttttta |
17844403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University