View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2080_high_5 (Length: 337)
Name: NF2080_high_5
Description: NF2080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2080_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 289; Significance: 1e-162; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 17 - 324
Target Start/End: Original strand, 33900207 - 33900515
Alignment:
| Q |
17 |
cacgatgatatttgcaaatgggatgcatgagaatggaaaagaagcactttttctcttcgagaagatgctactatcaatttaaaaatttaaaaatatgata |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33900207 |
cacgatgatatttgcaaatgggatgcatgggaatggaaaagaagcactttttctcttcgagaagatgctactatcaatttaaaaatttaaaaatatgata |
33900306 |
T |
 |
| Q |
117 |
aatttgacacgcccaattgcagatgg-tgttgattttagattcagcaattgatcttgtactttaatttgagatgccttgatatggaataaaggacaaatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33900307 |
aatttgacacgcccaattgcagatgggtgttgattttagattcagcaattgatcttgtactttaatttgagatgccttgatatggaataaaggacaaatg |
33900406 |
T |
 |
| Q |
216 |
aatttataattggtttgttcagattaaatacatgaaaatcagttgatgagggggaaaacttgcttaccatttttatgtgagttttaaaatatgtacggaa |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33900407 |
aatttataattggtttgttcagattaaatacatgaaaatcagttgatgagggggaaaacttgcttaccatttttatgtgagttttgaaatatgtacggaa |
33900506 |
T |
 |
| Q |
316 |
cgatgatgt |
324 |
Q |
| |
|
| ||||||| |
|
|
| T |
33900507 |
ctatgatgt |
33900515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 27 - 93
Target Start/End: Complemental strand, 29055432 - 29055366
Alignment:
| Q |
27 |
tttgcaaatgggatgcatgagaatggaaaagaagcactttttctcttcgagaagatgctactatcaa |
93 |
Q |
| |
|
|||||||||| |||||| | |||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29055432 |
tttgcaaatgcgatgcacgggaatggaaaataagcattttttctcttcgagaagatgctactatcaa |
29055366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 29 - 94
Target Start/End: Complemental strand, 34636576 - 34636511
Alignment:
| Q |
29 |
tgcaaatgggatgcatgagaatggaaaagaagcactttttctcttcgagaagatgctactatcaat |
94 |
Q |
| |
|
|||||||| |||||| | |||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
34636576 |
tgcaaatgcgatgcacgggaatggaaaagaagcactctttctctttgagaagatgctactatcaat |
34636511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 21 - 94
Target Start/End: Complemental strand, 13793173 - 13793100
Alignment:
| Q |
21 |
atgatatttgcaaatgggatgcatgagaatggaaaagaagcactttttctcttcgagaagatgctactatcaat |
94 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
13793173 |
atgatctttgcaaatgggatgcatgggaatggaaaagaagcactttcactcttcgagaagatgctactatcaat |
13793100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 39 - 92
Target Start/End: Original strand, 28743087 - 28743140
Alignment:
| Q |
39 |
atgcatgagaatggaaaagaagcactttttctcttcgagaagatgctactatca |
92 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
28743087 |
atgcatgggaatggaaaagaagcgctttttctctttgataagatgctactatca |
28743140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University