View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2080_low_15 (Length: 218)
Name: NF2080_low_15
Description: NF2080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2080_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 21 - 204
Target Start/End: Original strand, 3439880 - 3440063
Alignment:
| Q |
21 |
ctagctaggctgtagtagttccattttttatgtggaaccgatttgtgttttccttctaatttcattagaacctaatgaattgtaaaatttggtgttgcag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3439880 |
ctagctaggctgtagtagttccattttttatgtggaaccgatttgtgttttccttctaatttcattagaacctaatgaattgtaaaatttggtgttgcag |
3439979 |
T |
 |
| Q |
121 |
gggattgtataaaaatcatgtagaactagaagtgtaaattttcttcaagatttctcagtttttggtatttgtgcttctattcat |
204 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3439980 |
gggattgtataaaaatcatgtagagctagaagtgtaaattttcttcaagatttctcagtttttggtatttgtgcttctattcat |
3440063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University