View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20811_low_3 (Length: 241)
Name: NF20811_low_3
Description: NF20811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20811_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 21947273 - 21947044
Alignment:
| Q |
1 |
tacatatgaattaaaaa----cactccaccttatatttctatgatattgattttttatttattgttaaactttcgttattgaaatcatctttaacat--n |
94 |
Q |
| |
|
||||||||||||||| | ||||||||||| |||||||||| ||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
21947273 |
tacatatgaattaaagacactcactccaccttgtatttctatggtattgattttttatttattgtaaaacttttgttattgaaatcatctttaacataaa |
21947174 |
T |
 |
| Q |
95 |
nnnnnncattaagagataatactccttactattatttctacggtattgattaatgatgatttgtgacacnnnnnnngccaaaaggaaaaaattgaacttt |
194 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
21947173 |
aaaaaacattaagagataagactccttactattatttctacggtattgattaatgatgatttgtaacaccttttttgccaaaaggaaaaaattgaacttt |
21947074 |
T |
 |
| Q |
195 |
gatggatgatgaaatgtgcaggagatcgtg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21947073 |
gatggatgatgaaatgtgcaggagatcgtg |
21947044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University