View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20813_low_12 (Length: 244)
Name: NF20813_low_12
Description: NF20813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20813_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 229
Target Start/End: Complemental strand, 53789137 - 53788928
Alignment:
| Q |
14 |
atcatttttcaacttctatctaatcaagttctccttttcttttccatatcaacataactaaaatacttataccatcgtctgtagttggattgcaacaatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53789137 |
atcatttttcaacttctatctaatcaagttctccttttcttttccatatcaacataactaaaatacttataccatcgtctgtagttggattgcaacaatt |
53789038 |
T |
 |
| Q |
114 |
g--cgttgtctttttgatggactcagatacggaaatgttataagaatgtataattgtatatgtaatttattattagctatagcctatagtttgttgcaac |
211 |
Q |
| |
|
| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
53789037 |
gcacgttgtctttttgatggactcagatac-gaaatgttataagaatgtataattgtatatgtaatttattattag-------ctatagtttgttgcgac |
53788946 |
T |
 |
| Q |
212 |
tagtggtattatgaaatg |
229 |
Q |
| |
|
| |||||||||||||||| |
|
|
| T |
53788945 |
ttgtggtattatgaaatg |
53788928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University