View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20813_low_2 (Length: 362)
Name: NF20813_low_2
Description: NF20813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20813_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 11 - 345
Target Start/End: Complemental strand, 11398190 - 11397856
Alignment:
| Q |
11 |
taactattcattgccatatattacgtgccttcatttccttggtggtgttctggagatcattttgcaaatttcgcagagagccttcaattagctgaggcat |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11398190 |
taactattcattgccatatattacgtgccttcatttccttggtggtgttctggagattattttgcaaatttcgcagagagccttcaattagctgaggcat |
11398091 |
T |
 |
| Q |
111 |
ggaagaaaccaacatatatacttcctgtaacttctctatgtctgtaacacggctcatttgttcagataaagatttcaaactcccattgatgcttgcttta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11398090 |
ggaagaaaccaacatatatacttcctgtaacttctctatgtctgtaacacggctcatttgttcagataaagatttcaaactcccattgatgcttgcttta |
11397991 |
T |
 |
| Q |
211 |
atttcttcttgtcctttcatctgatttaaaaccattgtctctcagtccattgaacttcactattcattgatgttagagaaatcatgcaagtcaagataga |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11397990 |
atttcttcttgtcctttcatctgatttaaaaccattgtctctcagtccattgaacttcactattcattgatgttagagaaatcatgcaagtcaagataga |
11397891 |
T |
 |
| Q |
311 |
aatcagctagttaccattaactgaagtgtgttatc |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
11397890 |
aatcagctagttaccattaactgaagtgtgttatc |
11397856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University