View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20814_high_10 (Length: 248)
Name: NF20814_high_10
Description: NF20814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20814_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 113 - 238
Target Start/End: Complemental strand, 36599351 - 36599226
Alignment:
| Q |
113 |
ttcactagtttgagtattaagagaagatggacttacaagtacatctgaagttgcattatcataaccagtagcagcagaagcaaaactgaccccagttgca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36599351 |
ttcactagtttgagtattaagagaagatggacttacaagtacatctgaagttgcattatcataaccagtagcagcagaagcaaaactgaccccagttgca |
36599252 |
T |
 |
| Q |
213 |
aaatctgaaatattatacttgggatc |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
36599251 |
aaatctgaaatattatacttgggatc |
36599226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 143 - 196
Target Start/End: Complemental strand, 36564325 - 36564272
Alignment:
| Q |
143 |
acttacaagtacatctgaagttgcattatcataaccagtagcagcagaagcaaa |
196 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
36564325 |
acttactagtacatcagaagttgcattatcatatccagttccagcagaagcaaa |
36564272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 153 - 214
Target Start/End: Original strand, 37385386 - 37385447
Alignment:
| Q |
153 |
acatctgaagttgcattatcataaccagtagcagcagaagcaaaactgaccccagttgcaaa |
214 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
37385386 |
acatctgaagtggcattatcataaccagtagcagcagaagcaaaggagacaccagttgcaaa |
37385447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 225
Target Start/End: Complemental strand, 26044623 - 26044563
Alignment:
| Q |
165 |
gcattatcataaccagtagcagcagaagcaaaactgaccccagttgcaaaatctgaaatat |
225 |
Q |
| |
|
||||||||| | |||||| ||||||||||||||| || ||||| ||||||||||| |||| |
|
|
| T |
26044623 |
gcattatcaaatccagtaccagcagaagcaaaacaaacaccagtagcaaaatctgatatat |
26044563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University