View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20814_high_11 (Length: 236)
Name: NF20814_high_11
Description: NF20814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20814_high_11 |
 | |
|
| [»] scaffold0015 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 28939940 - 28939721
Alignment:
| Q |
1 |
tggaagtggaagtggtgggagagttgatggattgttatggtacaaagatttagggaaccatatttatggtgaattttcaatggctgtgattcaagctaat |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28939940 |
tggaagtggaagtggtgagagagttgatggattgttatggtacaaagatttagggaaccatatttatggtgaattttcaatggctgtgattcaagctaat |
28939841 |
T |
|
| Q |
101 |
agttcattggaggatagaagtgaatttgagtctggacctttgagttctaaccatttgggtcctcaagggacttttattggtgtttatgatggtcatggtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28939840 |
agttcattggaggatagaagtgaatttgagtctggacctttgagttctaaccatttgggtcctcaagggacttttattggtgtttatgatggtcatggtg |
28939741 |
T |
|
| Q |
201 |
gagctgaagcttctcaattt |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
28939740 |
gagctgaagcttctcaattt |
28939721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 17 - 216
Target Start/End: Complemental strand, 40327511 - 40327312
Alignment:
| Q |
17 |
gggagagttgatggattgttatggtacaaagatttagggaaccatatttatggtgaattttcaatggctgtgattcaagctaatagttcattggaggata |
116 |
Q |
| |
|
|||| ||||||||||||| | ||||| || ||||| || |||||| ||||||||||||||||||||||||| |||||||| |||||||| ||||||||| |
|
|
| T |
40327511 |
gggaaagttgatggattgctgtggtataaggatttgggaaaccatctttatggtgaattttcaatggctgtaattcaagcaaatagttcgttggaggatc |
40327412 |
T |
|
| Q |
117 |
gaagtgaatttgagtctggacctttgagttctaaccatttgggtcctcaagggacttttattggtgtttatgatggtcatggtggagctgaagcttctca |
216 |
Q |
| |
|
| || || |||| || |||||| |||||||| | |||||||||||||||| || ||||| |||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
40327411 |
gtagccaacttgaatcaggacctatgagttctgattatttgggtcctcaaggaacctttataggtgtttatgatggtcatggtggaactgcagcttctca |
40327312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 214
Target Start/End: Complemental strand, 73558 - 73516
Alignment:
| Q |
172 |
ttttattggtgtttatgatggtcatggtggagctgaagcttct |
214 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
73558 |
ttttgttggtgtttatgatggtcatggtggtcctgaagcttct |
73516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University