View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20814_low_12 (Length: 230)
Name: NF20814_low_12
Description: NF20814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20814_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 17 - 190
Target Start/End: Original strand, 10410302 - 10410474
Alignment:
| Q |
17 |
tgatatggcttcatcctttttgtgctgatcatatctttctaaagttaaaactgtttacgatattctcctagagcccacacattggcaaaatatttctacc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
10410302 |
tgatatggcttcatcctttttgtgctgatcatatctttctaaagttaaa-ctgtttacgatattctcctagagcccacacattggaaaaatatttctatc |
10410400 |
T |
 |
| Q |
117 |
cattggataatttagcatgacagttttcaaagatcctcctgtcagctcctgcaataatgaataacccaagtaaa |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
10410401 |
cattggataatttagcatgacagttttcaaagatcctcctgtcagctcctgcaataataaataacacaagtaaa |
10410474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University