View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20814_low_9 (Length: 253)
Name: NF20814_low_9
Description: NF20814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20814_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 13 - 187
Target Start/End: Complemental strand, 20870495 - 20870321
Alignment:
| Q |
13 |
aaaatctatgggttagatttgaaaacctgccttcctcgaaaacactaattattattactactcaagtgtctagtctaatcacattacatgtttctatgtg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20870495 |
aaaatctatgggttagatttgaaaacctgccttcctcgaaaacactaattattattactactcaagtgtctagtctaatcacattgcatgtttctatgtg |
20870396 |
T |
 |
| Q |
113 |
nnnnnnnnagatgaatcctgtttctttgttaaaatcagaagaaacccaaagttaccttgcttgtgctagcaaatc |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20870395 |
ttctttttagatgaatcctgtttctttgttaaaatcagaagaaacccaaagttaccttgcttgtgctagcaaatc |
20870321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 236
Target Start/End: Complemental strand, 20870299 - 20870270
Alignment:
| Q |
207 |
aaagaatgagtaatgtagagaagaaggagg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
20870299 |
aaagaatgagtaatgtagagaagaaggagg |
20870270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University