View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20815_low_3 (Length: 236)
Name: NF20815_low_3
Description: NF20815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20815_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 24513869 - 24513656
Alignment:
| Q |
1 |
tgtataagatggtaaagttgaagttactgagatgatttctctttctttttatgtagcctgtctattccctaccagtctaaatcctgagattcttgagggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24513869 |
tgtataagatggtaaagttgaagttactgagatgatttctctttctttttatgtagcctgtctattccctaccagtctaaatcctgagattcttgagggt |
24513770 |
T |
 |
| Q |
101 |
ttgttggcatcaggtttgcattgctcaataannnnnnnnnnnnnnnnggcactttgatttgcaatgtatatttgttgattattctgttataattacagtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24513769 |
ttgttggcatcaggtttgcattgctcaataattttattttattttttggcactttgttttgcaatgtatatttgttgattattctgttataattacagtt |
24513670 |
T |
 |
| Q |
201 |
ggtggtgttatggc |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
24513669 |
ggtggtgttatggc |
24513656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 96
Target Start/End: Complemental strand, 41946979 - 41946914
Alignment:
| Q |
31 |
gatgatttctctttctttttatgtagcctgtctattccctaccagtctaaatcctgagattcttga |
96 |
Q |
| |
|
|||||||||| ||||||| | |||||||| ||||||||||| | | ||||||||||||||||||| |
|
|
| T |
41946979 |
gatgatttctttttctttctctgtagcctatctattccctagccgcttaaatcctgagattcttga |
41946914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University