View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20816_high_112 (Length: 209)
Name: NF20816_high_112
Description: NF20816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20816_high_112 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 63 - 194
Target Start/End: Complemental strand, 2564270 - 2564139
Alignment:
| Q |
63 |
tacaaacccatgtgcattgtgcactagcctcacaaatcattgcccgtggtcccaagaaaagatatatctttctcgactgggcaactaaccactaggtagg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2564270 |
tacaaacccatgtgcattgtgcactagcctcacaaatcattgcccgtggtcccaagaaaagatatatctttctcgactgggcaactaaccactaggtagg |
2564171 |
T |
 |
| Q |
163 |
tatacatgtgttgcccacaatttgttcatttt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2564170 |
tatacatgtgttgcccacaatttgttcatttt |
2564139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University