View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20816_high_113 (Length: 207)
Name: NF20816_high_113
Description: NF20816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20816_high_113 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 41422012 - 41422201
Alignment:
| Q |
1 |
atgatatgccataattattataatatgtttacgcaactttctattttggannnnnnnnacaagtatcttccggatgattttttgtcatgaccactcatcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41422012 |
atgatatgccataattattataatatgtttacgcaactttctattttggattttttttacaagtatcttccggatgattttttgtcatgaccactcatcg |
41422111 |
T |
|
| Q |
101 |
cccattttgaaccactagtttataactttccaacaagccaagttttgccactactcgtgatttaatatcacttgtccctacgtgtcaaat |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41422112 |
cccattttgaaccactagtttataactttccaacaagccaagttttgccactactcgtgatttaatatcacttgtccctacgtgtcaaat |
41422201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University