View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20816_high_20 (Length: 504)
Name: NF20816_high_20
Description: NF20816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20816_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 19643844 - 19644130
Alignment:
| Q |
1 |
aaagtcgatatcatggtttcgtcgttcaaaggatcctagtggaatcatcgatgatgatcgtgcttaggagtcacgctttttgaagcattgtttgtctgcg |
100 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19643844 |
aaagtcggtatcatggtttcgtcgttcgaaggatcctagtggaatcatcgatgatgatcgtgcttatgagtcacgctttttgaagcattgtttgtctgcg |
19643943 |
T |
 |
| Q |
101 |
catgtcgccatcttttgtggtccttttacgggattcaa-----------gttgttatttcctcagtcttgattatatattgttggatta--atgctgaag |
187 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
19643944 |
catgtggccatcttttgtggtccttttacgggattcaagaaagattgtggttgttatttccccagtcttgattatagattgttggattaatatgctgaag |
19644043 |
T |
 |
| Q |
188 |
aaatccagcagctttcctcaatgtacagtgttcccgagatttttaataagggtattgaaaaatgtaaaacaacatatcatccattaa |
274 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
19644044 |
aaatccagcagcttttctcaatgtacagtgttcccgagatttttaataagggtattgaaaaatgtaaaacagcatattatccattaa |
19644130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University