View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20816_high_52 (Length: 360)
Name: NF20816_high_52
Description: NF20816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20816_high_52 |
 |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |  |
|
| [»] scaffold0064 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 3e-33; HSPs: 8)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 11 - 83
Target Start/End: Complemental strand, 21221083 - 21221011
Alignment:
| Q |
11 |
cagagacatacacacaaatgcttccccctacaagttctgagaatgtcattatatggggaaatctttgtgtgtt |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21221083 |
cagagacatacacacaaatgcttccccctacaagttctgagaatgtcattatatggggaaatctttgtgtgtt |
21221011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 80 - 175
Target Start/End: Complemental strand, 21218806 - 21218711
Alignment:
| Q |
80 |
tgtttttatgacaattacaatggaaccgacttggttatatggcaactgacagaatttggagatgaaaggtcttggactcaattcctcaaatttagc |
175 |
Q |
| |
|
||||||||| || ||| ||||||||| || ||||||||||||||| |||| |||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
21218806 |
tgtttttatcacgatttcaatggaactgatttggttatatggcaaatgacggaatttggagatgataagtcttggactcaattcctcaaatttagc |
21218711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 271 - 345
Target Start/End: Complemental strand, 21216596 - 21216522
Alignment:
| Q |
271 |
tccgagcaaattcaacgttattgatggtgcatgtcataatgataggatgaaagagactctttttggagttacatt |
345 |
Q |
| |
|
|||||| |||||| ||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21216596 |
tccgagtaaattcgacgttattgatggcgcatgtcatgctgataggatgaaagagactctttttggagctacatt |
21216522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 80 - 175
Target Start/End: Complemental strand, 35206022 - 35205927
Alignment:
| Q |
80 |
tgtttttatgacaattacaatggaaccgacttggttatatggcaactgacagaatttggagatgaaaggtcttggactcaattcctcaaatttagc |
175 |
Q |
| |
|
||||||||| | ||| ||||||||| || || ||||||||| | |||||||||||||| |||| | |||||||||||||||||| ||||||||| |
|
|
| T |
35206022 |
tgtttttatcatgatttcaatggaactgattttgttatatggaagatgacagaatttggaaatgacaagtcttggactcaattccttaaatttagc |
35205927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 113 - 175
Target Start/End: Complemental strand, 13888159 - 13888097
Alignment:
| Q |
113 |
gttatatggcaactgacagaatttggagatgaaaggtcttggactcaattcctcaaatttagc |
175 |
Q |
| |
|
||||||||| || ||||| |||||||||| |||| |||||||||||||||||| ||||||||| |
|
|
| T |
13888159 |
gttatatggaaaatgacaaaatttggagacgaaaagtcttggactcaattccttaaatttagc |
13888097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 80 - 120
Target Start/End: Complemental strand, 21220997 - 21220957
Alignment:
| Q |
80 |
tgtttttatgacaattacaatggaaccgacttggttatatg |
120 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
21220997 |
tgtttttatgacaatttcaatggaaccaacttggttatatg |
21220957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 113 - 163
Target Start/End: Original strand, 7328183 - 7328233
Alignment:
| Q |
113 |
gttatatggcaactgacagaatttggagatgaaaggtcttggactcaattc |
163 |
Q |
| |
|
||||||||| | ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
7328183 |
gttatatggaagatgacagaatttggagatgacaggtcttggactaaattc |
7328233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 132 - 173
Target Start/End: Original strand, 20414906 - 20414947
Alignment:
| Q |
132 |
aatttggagatgaaaggtcttggactcaattcctcaaattta |
173 |
Q |
| |
|
||||||||||||| | |||||||||||||||||| ||||||| |
|
|
| T |
20414906 |
aatttggagatgacaagtcttggactcaattccttaaattta |
20414947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 104 - 175
Target Start/End: Original strand, 4133 - 4204
Alignment:
| Q |
104 |
accgacttggttatatggcaactgacagaatttggagatgaaaggtcttggactcaattcctcaaatttagc |
175 |
Q |
| |
|
||||| |||||||||||| | |||||||||||||| |||||| |||||||||||||||| |||| ||||| |
|
|
| T |
4133 |
accgatttggttatatggaagatgacagaatttggaaatgaaaattcttggactcaattccacaaagttagc |
4204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0064 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0064
Description:
Target: scaffold0064; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 113 - 175
Target Start/End: Original strand, 24210 - 24272
Alignment:
| Q |
113 |
gttatatggcaactgacagaatttggagatgaaaggtcttggactcaattcctcaaatttagc |
175 |
Q |
| |
|
||||||||| | ||||||||| ||||||||||| |||||| ||||||||||| ||||||||| |
|
|
| T |
24210 |
gttatatggaagatgacagaatatggagatgaaaagtcttgaactcaattccttaaatttagc |
24272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 113 - 175
Target Start/End: Original strand, 42298116 - 42298178
Alignment:
| Q |
113 |
gttatatggcaactgacagaatttggagatgaaaggtcttggactcaattcctcaaatttagc |
175 |
Q |
| |
|
||||||||| | ||| ||||||||||||||||| |||||||||||||||| |||| ||||| |
|
|
| T |
42298116 |
gttatatggaagatgatagaatttggagatgaaaattcttggactcaattccacaaagttagc |
42298178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 113 - 174
Target Start/End: Original strand, 53774845 - 53774906
Alignment:
| Q |
113 |
gttatatggcaactgacagaatttggagatgaaaggtcttggactcaattcctcaaatttag |
174 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| |||||||||||||||||| ||| |||| |
|
|
| T |
53774845 |
gttatatggcaaatgaaggaatttggagttgaagagtcttggactcaattccttaaaattag |
53774906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University