View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20816_high_53 (Length: 356)
Name: NF20816_high_53
Description: NF20816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20816_high_53 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 16 - 349
Target Start/End: Complemental strand, 49592698 - 49592365
Alignment:
| Q |
16 |
ggttgaatataatcttgttactctgctgtgccacatcctcatagcccttatgctcattctctttatttggtataatgcagctggattaatcacttggtaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49592698 |
ggttgaatataatcttgttactctgctgtgccacatcctcatagcccttatgctcattctctttatttggtataatgcagctggattaatcacttggtaa |
49592599 |
T |
|
| Q |
116 |
ttgtatttttaaccttataaaaattatcaatatgtgcagtccctattcaaaagccttatttttgtaacatttggagtaaacattatttatgtgttgcatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49592598 |
ttgtatttttaaccttataaaaattatcaatatgtgcagtccctattcaaaagccttatttttgtaacatttggagtaaacattatttatgtgttgcatt |
49592499 |
T |
|
| Q |
216 |
gcaggaaacttcctgatatctatgattttgaaatcccagattctaccgttagattcattcataaaaagttcaacttgttcttgaggaaattttatgacat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49592498 |
gcaggaaacttcctgatatctatgattttgaaatcccagattctaccgttagattcattcataaaaagttcaacttgttcttgaggaaattttatgacat |
49592399 |
T |
|
| Q |
316 |
ttcaactgggaaagaccttagattcttctctgtg |
349 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
49592398 |
ttcaactgggaaagaccttagattcttctttgtg |
49592365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University