View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20816_high_61 (Length: 317)
Name: NF20816_high_61
Description: NF20816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20816_high_61 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 19 - 309
Target Start/End: Original strand, 33907639 - 33907929
Alignment:
| Q |
19 |
gcattggttatgggccaaaacattaacatcgtgtcccttgtgattgtcgttcggcctctgattcaaatgaacgaggacatgttcgtcaatccttaggatt |
118 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33907639 |
gcattggttatgggccaaaacattaacgtcgtgtcccttgtgattgtcgttcggcctctgattcaaatgaacgaggacatgttcgtcaatccttaggatt |
33907738 |
T |
 |
| Q |
119 |
tcgttatgaatttaaggctgttgaacttcaccttgttccagaataccaacacccatgaattggtttaatgtagccatttggttggccatagccatagaag |
218 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33907739 |
tcgttatgaaattaaggctgctgaacttcaccttgttccagcataccaacacccatgaattggtttaatgtagccatttggttggccatagccatagaag |
33907838 |
T |
 |
| Q |
219 |
catggtttgtattcttgatcaacaacgtgataactgccccatctgttgagttaactgttctccttctgattgttgctatttatccatctgt |
309 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||||||| || ||||| ||||||||| |||||||||| ||||||||| |
|
|
| T |
33907839 |
catggtttgtattcttgatcaactatgtgataactgccccatctgttgagtgaaatgttcaccttctgatggttgctatttgtccatctgt |
33907929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University